View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_305 (Length: 252)
Name: NF9288A_low_305
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_305 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 16 - 252
Target Start/End: Complemental strand, 45565970 - 45565734
Alignment:
| Q |
16 |
atttgagtgggaggattattggcacaagcagaagcattttggaaacaaatagcaaaggtgatttggcttaaggatggtgacaccaatgcgcgattctttc |
115 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45565970 |
atttgaatgagaggattattggcacaagcagaagcattttggaaacaaatagcaaaggtgatttggcttaaggatggtgataccaatgcgcgattctttc |
45565871 |
T |
 |
| Q |
116 |
aagccatggcgagtgcaaagagatgatgcaatacttttacaaacttgaagaaagatgataggactttggttgtggcgcaacatgaactttacgtggttgc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45565870 |
aagccatggcgagtgcaaagagatgatgcaatacttttacaaacttgaagaaagatgataggactttggttgtggcgcaacatgaactttacgtggttgc |
45565771 |
T |
 |
| Q |
216 |
tagctcctattttatgaattctgcgtgcaaagagatg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45565770 |
tagctcctattttatgaattctgcgtgcaaagagatg |
45565734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 34 - 95
Target Start/End: Complemental strand, 8179449 - 8179388
Alignment:
| Q |
34 |
ttggcacaagcagaagcattttggaaacaaatagcaaaggtgatttggcttaaggatggtga |
95 |
Q |
| |
|
|||||||||| |||||| |||||||| |||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
8179449 |
ttggcacaagaagaagcgttttggaagcaaagagctaaggtgatttggctgaaggatggtga |
8179388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University