View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_309 (Length: 251)
Name: NF9288A_low_309
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_309 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 114 - 239
Target Start/End: Complemental strand, 8885077 - 8884952
Alignment:
| Q |
114 |
ccattatattttatgcattatagataattctatttgaatgtaacaaaataataataattctattcaagacgtgtcggtactaaatgtaaatattaatttt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
8885077 |
ccattatattttatgcattatagataattctatttgaatgtaacaaaataataataattctattcaagatgtgccggtactaaatgtaaatattaatttt |
8884978 |
T |
|
| Q |
214 |
atatttgagccttgatatgcgatatt |
239 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
8884977 |
atatttgagccttgatatgcgatatt |
8884952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 8885190 - 8885113
Alignment:
| Q |
1 |
tggtttttgagactgactttaagcgcctctacatattatgactagatattctatgttgcctttgtaaccttctttgat |
78 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8885190 |
tggtttttgaaactgactttaagcgcctccacatattatgactagatattctatgttgcctttgtaaccttctttgat |
8885113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University