View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_322 (Length: 250)
Name: NF9288A_low_322
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_322 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 35041146 - 35041183
Alignment:
| Q |
18 |
acatcaatacatcattccacctatgctaaaaaatatcg |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35041146 |
acatcaatacatcattccacctatgctaaaaattatcg |
35041183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University