View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_323 (Length: 250)
Name: NF9288A_low_323
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_323 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 7e-30; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 168 - 242
Target Start/End: Complemental strand, 1956853 - 1956779
Alignment:
| Q |
168 |
tttttaccttgatgccatgataaggaatatcacaaaagatgtctcactaattgcaaaaccctttatcttcatctc |
242 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1956853 |
tttttacctagatgccatgataaggaatatcacaaaagatgtctcactaattgcaaaaccctttatcttcttctc |
1956779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 169 - 242
Target Start/End: Complemental strand, 1941761 - 1941688
Alignment:
| Q |
169 |
ttttaccttgatgccatgataaggaatatcacaaaagatgtctcactaattgcaaaaccctttatcttcatctc |
242 |
Q |
| |
|
|||||||| |||||||||| |||||| || | ||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1941761 |
ttttacctagatgccatgagaaggaagattaaaaaagctgtctcactaattgcaaaaccctttatcttcttctc |
1941688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 1927701 - 1927578
Alignment:
| Q |
120 |
aatattatgaaggtataaacataaataaaacaaaacaagttttagt-attttttaccttgatgccatgataaggaatatcacaaaagatgtctcactaat |
218 |
Q |
| |
|
||||||||||||||| |||||| ||||||| |||| || | | | | ||||||||||| |||||||||| ||| ||||| ||||| ||| ||||| || |
|
|
| T |
1927701 |
aatattatgaaggtaaaaacatcaataaaataaaataattgtaatttattttttacctagatgccatgagaagaaatattgtaaaagctgtttcacttat |
1927602 |
T |
|
| Q |
219 |
tgcaaaaccctttatcttcatctc |
242 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
1927601 |
tgcaaaaccctttatcttcttctc |
1927578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University