View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_336 (Length: 249)
Name: NF9288A_low_336
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_336 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 4050098 - 4050341
Alignment:
| Q |
1 |
aagcaactagtaagcatcgagataccgttttctttcattttcttcgaca-tccgctttgcctcaaggagtttcttacctgattgaatcctctcctaaaat |
99 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4050098 |
aagcaactagtaatcatcgagataccgttttctttcattttcttctgcaatccgctttgcctcaaggagtttcttacctgattgaatcctctcctaaaat |
4050197 |
T |
 |
| Q |
100 |
cataccattgaaaagataatgaaaatctatgctagaatgtttaagggataactgctagagatgaaaccagaattaatgaaaatcatagtaactgcatgct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4050198 |
cataccattgaaaagataatgaaaatctatgctagaatgtttaagggataactgctagagatgaaaccagaattaattaaaatcatagtaactgcatgct |
4050297 |
T |
 |
| Q |
200 |
tattggctatactatgaaaatagcgcaacttatatattcttgga |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
4050298 |
tattggctatactatgaaaatagcgcaacttgtatatttttgga |
4050341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University