View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_342 (Length: 249)
Name: NF9288A_low_342
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_342 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 110 - 241
Target Start/End: Original strand, 7059380 - 7059511
Alignment:
| Q |
110 |
tggccatgtccagagattggtttactcgacaagtcttttgatgaagatagtagaatggtaaaaaggtacttgccaactttgggatggagctcaaatttga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7059380 |
tggccatgtccagagattggtttactcgacaagtcttttgatgaagatagtagaatggtaaaaaggtacttgccaactttgggatggagctcaaatttga |
7059479 |
T |
|
| Q |
210 |
agactcaaccaatcatctatgctttacaaaac |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7059480 |
agactcaaccaatcatctatgctttacaaaac |
7059511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 18 - 115
Target Start/End: Complemental strand, 7059646 - 7059549
Alignment:
| Q |
18 |
catcatattactagtatgagtcaggtactggtacaagcaattcacaagctgtttcttcttgttctccatctcctgcccaaatttcaaacctctggcca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7059646 |
catcatattactagtatgagtcaggtactggtacaagcaattcacaagctgtttcttctggttctccatctcctgcccaaatttcgaacctctggcca |
7059549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University