View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_346 (Length: 248)
Name: NF9288A_low_346
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_346 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 38 - 248
Target Start/End: Complemental strand, 34571157 - 34570947
Alignment:
| Q |
38 |
gacatcagatcctcaatggaatggtttgtccttctgacttgccacttaattgctnnnnnnnttgtttcaatttgaatgtttatttacttatattctgtat |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34571157 |
gacatcagatcctcaatggaatggtttgtccttctgacttgccacttaattgctaaaaaaattgtttcaatttgaatgtttctttacttatattctgtat |
34571058 |
T |
|
| Q |
138 |
tggttttatatactaatatgcagagatattagagtttgatgctatggaagaaccaccatcagttttgtatgtggaagtttttgattttgacggtccattt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34571057 |
tggttttatatactaatatgcagagatattagagtttgatgctatggaagaaccaccatcagttttgtatgtggaagtttttgattttgacggtccattt |
34570958 |
T |
|
| Q |
238 |
gaccaggatgt |
248 |
Q |
| |
|
||||||||||| |
|
|
| T |
34570957 |
gaccaggatgt |
34570947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University