View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_356 (Length: 248)
Name: NF9288A_low_356
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_356 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 46582039 - 46581808
Alignment:
| Q |
1 |
aagaatgcatgttatgattatttggatgcttggtgagatgttgttatgagacattctcattctgaaattctctttgtaaaggacgacttatattatatag |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
46582039 |
aagaatgcatgttattattatttggatgcttgatgagatgttgttatgagacattctcattctgaaattctcgttgtaaaggatgacttatattatatag |
46581940 |
T |
|
| Q |
101 |
cagatataaagaaatatctgctttgcttatttctttagaaagagaaagggtttaagaattttgtattctttgatannnnnnnnnnaatttctcacatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46581939 |
cagatataaagaaatatctgctttgcttatttctttagaaagagaaagggtttaagaattttgtattctttgat-ttttttttttaatttctcacatatt |
46581841 |
T |
|
| Q |
201 |
tacttcaccagaatagaatcactgtcatactat |
233 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
46581840 |
tacttcactagaatagaatcactgtcatactat |
46581808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University