View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_371 (Length: 246)
Name: NF9288A_low_371
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_371 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 24 - 246
Target Start/End: Complemental strand, 3660197 - 3659975
Alignment:
| Q |
24 |
aagaggttgctgtgaaaaagcttatgcattatgttaaggcggtaaagagttcgagatctggtcagaaagttcggagaccaagaaaaccagaaggggatga |
123 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
3660197 |
aagaggttgctgcgaaaaagcgtatgcattatgttaaagcggtaaagagttcgagatctggtcagaaagttcagagaccaagaaaaccagaaggtgatga |
3660098 |
T |
 |
| Q |
124 |
tgatgagaagaagaagctgttgaagaatttgagggggagagttgagaagattagcaaattgtgtaaggtttatggagatgatgaggaaggtttagagaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3660097 |
tgatgagaagaagaagctgttgaagaatttgagggggagagttgagaagattagcaaattgtgtaaggtttatggagatgatgaggaaggtttagagaat |
3659998 |
T |
 |
| Q |
224 |
gaggagagcgttcatgattatga |
246 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
3659997 |
gaggagagcgttcatgatgatga |
3659975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University