View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_379 (Length: 244)
Name: NF9288A_low_379
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_379 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 39495638 - 39495413
Alignment:
| Q |
1 |
aagcatgcatatgactgatatcatcagagagtagaaaatagattaatgcatattatatagcagggtgatggtacactactaatgttttatgaatttaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39495638 |
aagcatgcatatgactgatatcatcagagagtagaaaatagattaatgcatattatatagcagggtgatggtacactactaatgttttatgaatttaact |
39495539 |
T |
|
| Q |
101 |
tcatggtttagtgcttatgatttgtgaatacaggcattgtgtagagtatatt--ggtaagctattatgcagtgttaatagtattagtaactgataattac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39495538 |
tcatggtttagtgcttatgatttgtgaatacaggcattgtgtagagtatattggggtaagctattatgcagtgtgaatagtattagtaactgataattac |
39495439 |
T |
|
| Q |
199 |
ataagttgttatgttagtcatcgtat |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
39495438 |
ataagttgttatgttagtcatcgtat |
39495413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University