View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_386 (Length: 244)
Name: NF9288A_low_386
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_386 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 22 - 231
Target Start/End: Complemental strand, 23840619 - 23840408
Alignment:
| Q |
22 |
cgattttggtcgaaattcatcgatgacaaggtaacnnnnnnnc--agtgtcttttttagtctttgtacttcgtataacgggttgtctttgtgttgcgatc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| | ||||||||| | |||||||| |||||| |||||||| ||||||||||| |
|
|
| T |
23840619 |
cgattttggtcgaaattcatcgatgacaaggtaacttcttcttttagtattttttttagtatatgtacttcctataacacgttgtcttcgtgttgcgatc |
23840520 |
T |
 |
| Q |
120 |
cttaatattgtgtagaatcgcgattagatataactgatgcaaccgttatgtcacagcctacatagctgtcataaatctttatttaaacctgtgctccgta |
219 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||| |||||||||| ||| ||||||||| || |||||||||||||| |||||| || |
|
|
| T |
23840519 |
cttaatattgcgtagaatcgcggttagatataactgatgcaaccattatgtcacaagctagatagctgtcgcaagtctttatttaaaccgttgctcccta |
23840420 |
T |
 |
| Q |
220 |
tctttgtttctt |
231 |
Q |
| |
|
| ||||||||| |
|
|
| T |
23840419 |
ttgttgtttctt |
23840408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 55
Target Start/End: Complemental strand, 23861270 - 23861237
Alignment:
| Q |
22 |
cgattttggtcgaaattcatcgatgacaaggtaa |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
23861270 |
cgattttggtcgaaattcatcgatgacaaggtaa |
23861237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 56
Target Start/End: Complemental strand, 23844067 - 23844033
Alignment:
| Q |
22 |
cgattttggtcgaaattcatcgatgacaaggtaac |
56 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23844067 |
cgattttggtcaaaattcatcgatgacaaggtaac |
23844033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University