View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_396 (Length: 243)
Name: NF9288A_low_396
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_396 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 235
Target Start/End: Complemental strand, 19506528 - 19506312
Alignment:
| Q |
19 |
cagtagtctctgagactctcatatctcactggattcccaacggatgaacccacatgatatatgctatcatcacaaggttgatttgcatgacttaccatgg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506528 |
cagtagtctctgagactctcatatctcactggattcccaacagatgaacctacgtgatatatgctatcatcacaaggttgatttgcatgacttaccatgg |
19506429 |
T |
|
| Q |
119 |
ccactagcattgcattcaccaccatatcagcagggatctgcttcaaattaacacaagcataagtataaatcaattttgtctaggcctaattatacattta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506428 |
ccactagcattgcattcaccaccatatcagcagggatctgcttcaaattaacacaagcataagtataaatcaattttgtctaggcctaattatacattta |
19506329 |
T |
|
| Q |
219 |
gttatgttatatttttc |
235 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
19506328 |
gttatgttatttttttc |
19506312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 93 - 161
Target Start/End: Original strand, 36194258 - 36194326
Alignment:
| Q |
93 |
aggttgatttgcatgacttaccatggccactagcattgcattcaccaccatatcagcagggatctgctt |
161 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| ||||||||| |||||||| ||||| || |||||||| |
|
|
| T |
36194258 |
aggttgatttgcatgagccaccatagccactaacattgcattgaccaccatgtcagctggtatctgctt |
36194326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University