View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_425 (Length: 238)
Name: NF9288A_low_425
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_425 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 9 - 201
Target Start/End: Complemental strand, 25070458 - 25070266
Alignment:
| Q |
9 |
atgtcgaagaatatatggcagtcttcaatcatacatgttcaatagtagaggggtggacaaaactttatcatggtttttcagcatgtgggtaatgaaagtt |
108 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25070458 |
atgtcaaagaaaatatggcagtcttcaatcatacatgttcaatagtagaggggtgggcaaaactttatcatggtttttcagcatgtgggtaatgaaagtt |
25070359 |
T |
 |
| Q |
109 |
gattttgtgttgtgatttaattgagccaattgttgggtctttgatactatatgttcattaatcataaatggatgatttttggcttattcaaag |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25070358 |
gattttgtgttgtgatttaattgagccaattgttgggtctttgatactatatgttcattaatcataaattgatgatttttggcttattcaaag |
25070266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University