View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_436 (Length: 235)
Name: NF9288A_low_436
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_436 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 30 - 218
Target Start/End: Complemental strand, 27920668 - 27920480
Alignment:
| Q |
30 |
aaaggacgaccaattgcatatttcagcaaagcactcggggacggaaatttaacaaaagcggcttatgagaaaaagttaatcgcagtacctttatcatcca |
129 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
27920668 |
aaagggcggccaattgcatatttcagcaaagcactcggggacggaaatttaacaaaagcagcttatgagaaaaagttaatcgcgttagctttatcatcca |
27920569 |
T |
|
| Q |
130 |
acattggcgtccatatttcacggggtgaaaagttactgtttgtactgatcagaaaaagtttaaggcagctattgcagcagccagttact |
218 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| || || ||||||||||||||||||| ||||| |
|
|
| T |
27920568 |
acattggcgtccacatttcacggggtgaaaagtcactgtttgtactgatcagaaaagtttaaatgcagctattgcagcagccaattact |
27920480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 41 - 208
Target Start/End: Complemental strand, 17903688 - 17903521
Alignment:
| Q |
41 |
aattgcatatttcagcaaagcactcggggacggaaatttaacaaaagcggcttatgagaaaaagttaatcgcagtacctttatc-atccaacattggcgt |
139 |
Q |
| |
|
|||||||||||| || |||||||| |||||| ||||||||||||| | |||||||||||| ||||||| |||||| ||||||| ||||| ||||||||| |
|
|
| T |
17903688 |
aattgcatattttagtaaagcactaggggacagaaatttaacaaagtcagcttatgagaaagagttaatggcagtagctttatctatccagcattggcgt |
17903589 |
T |
|
| Q |
140 |
ccatatttcacggggtgaaaagttactgtttgtactgatcagaaaaagtttaaggcagctattgcagca |
208 |
Q |
| |
|
|||||||| | |||| ||||| | |||||||||||||| ||| || || ||||| |||||||||||||| |
|
|
| T |
17903588 |
ccatatttaatggggcgaaaattcactgtttgtactgaccag-aagagcttaagacagctattgcagca |
17903521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University