View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_437 (Length: 234)
Name: NF9288A_low_437
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_437 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 23 - 212
Target Start/End: Original strand, 15250238 - 15250428
Alignment:
| Q |
23 |
atgatttgcaacgtgttgtgttgtttgggggacctggtggattctgtggtctttggaacatgtggttgtagatgatattggtcagaatgactttaattta |
122 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15250238 |
atgatttgcaacgtgttgtgttgtttggtggacctggtggattctgtggtctttaaaacatgtggttgtagatgatattggtcagaattactttaattta |
15250337 |
T |
 |
| Q |
123 |
ataaatgtatcatgggttctattttgtttcaaagtgatgatagttaata----ttatttactgttagcatgatgcactaaaaagttaaaacaac |
212 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15250338 |
ataaatgtgtcatgggttctattttgtttcaaag---tgatagttaatattatttatttactgttagcatgatgcactaaaaagttaaaacaac |
15250428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University