View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_446 (Length: 232)
Name: NF9288A_low_446
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_446 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 22 - 217
Target Start/End: Original strand, 22730095 - 22730290
Alignment:
| Q |
22 |
tctccgacagttgaaagtatgaaaccacttgaaaaattacctgtttgtcaggacctataggcctagagcagcacttacattaataacattggtaaataaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22730095 |
tctccgacagttgaaagtatgaaaccacttgaaaaattacctgtttgtcaggacctataggcctagagcaacacttacattaataacattggtaaataaa |
22730194 |
T |
 |
| Q |
122 |
taatcatgcaaaaagggaccacaagaacccccatcctttcaaatgtttctattctccatgtttgattggacaccatatagtttctcattcatctca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22730195 |
taatcatgcaaaaagggaccacaagaacccccatcctttcaaatgtttctattctccatgtttgattggacaccatatagtttctcattcatctca |
22730290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University