View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_455 (Length: 230)
Name: NF9288A_low_455
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_455 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 108 - 224
Target Start/End: Complemental strand, 3237190 - 3237074
Alignment:
| Q |
108 |
ttgaaccagctctcatatcatattaaatgtgtttgaatcacattcaaaaagctagttcaaagaatgaaggttctcaacatatttatacattcaatactca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3237190 |
ttgaaccagctctcatatcatattaaatgtgtttgaatcacattcaaaaagctagttcaaagaatgaaggttctcaacatatttatacattcaatactta |
3237091 |
T |
|
| Q |
208 |
gtagtcgaggaatttga |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3237090 |
gtagtcgaggaatttga |
3237074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 38 - 111
Target Start/End: Complemental strand, 3237293 - 3237220
Alignment:
| Q |
38 |
caaaggaaaaattgcttggacttaatgaatgaatatggacttctaggttgcaaacctgcagccacttccgttga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3237293 |
caaaggaaaaattgcttggacttaatgaatgaatatggacttcaaggttgcaaacctgcagccacttccgttga |
3237220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University