View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_46 (Length: 418)
Name: NF9288A_low_46
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 1 - 410
Target Start/End: Original strand, 38359691 - 38360101
Alignment:
| Q |
1 |
catctcatgatggaagtctctcctttaaagatgcatatcgttttcatacttcccctcatcctcaaaacattagttgcgctgaaactatttggcatgctac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||| | |
|
|
| T |
38359691 |
catctcatgatggaagtctctcctttaaagatgcatatcgttttcatacttcccctcatcctcaaaacattagttgggctaaaactatttgtaatgctgc |
38359790 |
T |
|
| Q |
101 |
tattgcccccctccaagcctcttcttgtttggaggattcttctcaacaagctccccacatatgacattcttgcgaaaagaggttgtttgcttccctctat |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38359791 |
tattgtccccctccaagcctcttcttgtttggaggattcttctcaacaagctccccacagatgacattcttgcgaaaagaggttgtttgcttccctctat |
38359890 |
T |
|
| Q |
201 |
ttgttctctttgtggaaaaatcaagaaactcaatctcacatgttccttgaatgcactttctcttatgacatttgg-cctggttgtttcacattctcaaaa |
299 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38359891 |
tttttctctttgtggaaaaatcaagaaactcaatctcacatgttccgtgaatgcactttctcttatgacatttggtcctggttgtttcacattctcaaaa |
38359990 |
T |
|
| Q |
300 |
tcacctgaaacttttcatgttttttggacatcataaggatagctgaaagaaattggtccccgcattgtagattggttgctctatctgccataattcactt |
399 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| || |||||| ||||||||||||||||||||||||||| |
|
|
| T |
38359991 |
tcacctgaaacttttcaagttttttggacatcataaggatagctaaaagaaattggtccccacaatgtagactggttgctctatctgccataattcactg |
38360090 |
T |
|
| Q |
400 |
cttcaacacca |
410 |
Q |
| |
|
||||||||||| |
|
|
| T |
38360091 |
cttcaacacca |
38360101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University