View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_464 (Length: 230)
Name: NF9288A_low_464
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_464 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 47583895 - 47583682
Alignment:
| Q |
1 |
gaatgctagaaatgacatcatattttggggaaaacatgcaaaggtggaagaggtagtatgtaagatcaagcacttgtcttggaattggttttggagaaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583895 |
gaatgctagaaatgacatcatattttggggaaaacatgcaaaggtggaagaggtagtatgtaagatcaagcacttgtcttggaattggttttggagaag- |
47583797 |
T |
 |
| Q |
101 |
aaaatagggg--tatccttgtttattttgtgtagattgtatcggtaggaaatgatgtattgggaattttgagtggatagagtattattacttatatcttt |
198 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47583796 |
aaaataggggtatatccttgtttattttgtgtagattgtatcggtaggaaatgatgtattgggaattttgagtggatagagtattattacttatatc-tt |
47583698 |
T |
 |
| Q |
199 |
atctatttgaataaaa |
214 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
47583697 |
atctatttgaataaaa |
47583682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University