View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_47 (Length: 417)
Name: NF9288A_low_47
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 7e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 7e-93
Query Start/End: Original strand, 23 - 245
Target Start/End: Original strand, 13118235 - 13118457
Alignment:
| Q |
23 |
gttccaacctcttttgtcttcttttttcagtcttaacttagggttgctttgtccttaggacgactcaaaatgcaggaatcctaattgtcttaaataattt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13118235 |
gttccaacctcttttgtcttcttttttcagtcttaacttagggttgctttgtccttaggacgactcaaaatgcaggaatcctagttgtcttaaataattt |
13118334 |
T |
|
| Q |
123 |
tgcaggaatttattcaatttatttcccatatgcattatcatccctaaggaatccgtatcagtannnnnnncttcttctcatgcataactttgcattaatt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
13118335 |
tgcaggaatttattcaatttatttcccatatgcattatcatccctaaggaatccgtatcagtatttttt--tttttctcatgcataactttgcattaatt |
13118432 |
T |
|
| Q |
223 |
ccttggat--agtgtatgaagtacg |
245 |
Q |
| |
|
|||||||| || |||||||||||| |
|
|
| T |
13118433 |
ccttggataaagagtatgaagtacg |
13118457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 272 - 412
Target Start/End: Original strand, 13118444 - 13118583
Alignment:
| Q |
272 |
gagtatgaagtacgtaacttaaagcaaattatttactatttatgacatgaacttcaaaccatttattattctcattacagaagcacaatcattgttcnnn |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13118444 |
gagtatgaagtacgtaacttaaagcaaattatttactatttatgacatgaacttcaaaccatttattattctcattacagaagcacaatcattgttc-tt |
13118542 |
T |
|
| Q |
372 |
nnnnctttgtttgtaacgaacaattattcgttcatatcagt |
412 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
13118543 |
ttttctttgtttgtaactaacaattattcgtttatatcagt |
13118583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University