View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_490 (Length: 230)
Name: NF9288A_low_490
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_490 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 112 - 224
Target Start/End: Complemental strand, 39392811 - 39392699
Alignment:
| Q |
112 |
ggttataaccttctacactatcttcaagatagcatcaaaatttcaacgtgccgcaccctgctgcaaagtttgtgttacaactgtgccaagatcacagcag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39392811 |
ggttataaccttctacactatcttcaagatagcatcaaaatttcaacgtgccgcaccctgctgcaaagtttgtgttacaactgtgccaagatcacagcag |
39392712 |
T |
|
| Q |
212 |
taaagttaagaac |
224 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39392711 |
taaagttaagaac |
39392699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 8 - 73
Target Start/End: Complemental strand, 39392910 - 39392845
Alignment:
| Q |
8 |
agttgttttttccactaagacctaggtcggtttggaccgaactgaaaaaacaattttgatgtgttt |
73 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39392910 |
agttgttttttccattaagatctaggtcggtttggaccgaactgaaaaaacaattttgatgtgttt |
39392845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University