View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_493 (Length: 230)
Name: NF9288A_low_493
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_493 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 46582285 - 46582062
Alignment:
| Q |
7 |
ggttgtgtcactgtaaatggaggaggctgttgttgatacactggcattgacgacgatgaagatgatgac-atta-attgtgtttccttttacagaaacta |
104 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || || | ||||||||||||||||||||||||| |
|
|
| T |
46582285 |
ggttgtgtcactgtaaacggaggaggctgttgttgatacactggcattgacgacgatgaagatgaagatgatgacattgtgtttccttttacagaaacta |
46582186 |
T |
 |
| Q |
105 |
gaacaagttcttagtagttggttgtttggattggtaggttagattgaatgtaaggaagtagttggagaataagcgatgcggagttaaacagaattactac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
46582185 |
gaacaagttcttagtagttggttgtttggattggtaggttagattgaatgtaaggaagtagttggataataagcaatgcggagttaaacagaattactac |
46582086 |
T |
 |
| Q |
205 |
tggcaccactttaattacttgtaa |
228 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
46582085 |
tggcaccactttaattacttgtaa |
46582062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University