View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_500 (Length: 229)
Name: NF9288A_low_500
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_500 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 8885382 - 8885607
Alignment:
| Q |
1 |
gttaacattaagttgaatattataaaatcaaaattgttctatatatgaacaacgt--tgcatatcaaagcaaattctttatcactccaa-ccacaatgtt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8885382 |
gttaacattaagttgaatattataaaatcaaaattgttctatatatgaacaacatattgcatatcaaagcaaattctttatcactccaaaccacaatgtt |
8885481 |
T |
|
| Q |
98 |
tctatctcaaaccacaaaatcactatatcactccacaaaaatctatattaaaacgaatataattttaaggttcttcggcatcttcttctcctctttctaa |
197 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8885482 |
tctatctcaaaccacaaaatcactttatcactccacaaaaatttatattaaaaccaatataattttagggttcttcggcatcttcttctcctctttctaa |
8885581 |
T |
|
| Q |
198 |
ttcttgaaacaaagaactgaagtatc |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
8885582 |
ttcttgaaacaaagaactgaagtatc |
8885607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University