View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_506 (Length: 229)
Name: NF9288A_low_506
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_506 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 3015795 - 3015575
Alignment:
| Q |
1 |
tgctagctcatgcagcatgttccttgacatatcagaatgcataaaatctaatactctctaagattctttgtttaataacgatgatgatgacgacgacgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3015795 |
tgctagctcatgcagcatgttccttgacatttcagaatgcataaaatctaatactctctaagattctttgtttaataacgatgatgatgatgacgac--- |
3015699 |
T |
 |
| Q |
101 |
tttgaccttttaattctacagaaacaagtgaggtagaattgacatcaacaatggaaacaggagcacgatgacgaggacgatagcaagaagtatgacataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3015698 |
tttgaccttttaattctacagaaacaagtgaggtagaattgacatcaacaatggaaacaggagcacgatgacgaggacgatagcaagaagtatgacataa |
3015599 |
T |
 |
| Q |
201 |
caagtccatttccttgaatccttt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3015598 |
caagtccatttccttgaatccttt |
3015575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University