View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_507 (Length: 229)
Name: NF9288A_low_507
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_507 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 14 - 217
Target Start/End: Complemental strand, 44201935 - 44201732
Alignment:
| Q |
14 |
tgacatcatctatggaggagacttatttgaatttgcataagatgaaatgtgtgaatttgtttagatctgctgacacaacaacaataaaatatatttttcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44201935 |
tgacatcatctatggaggagacttatttgaatttgcatcggatgaaatgtatgaatttgttgagatctgctgacacaacaacaataaaatatatttttct |
44201836 |
T |
 |
| Q |
114 |
ttttcttttagtgagattataattgaaataaaatgattatgttgagtttgacataaaatgaattaagttggcgaaattattgagatttgttaaatattct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| | |
|
|
| T |
44201835 |
ttttcttttagtgagattataattgaaataaaatgattatattgagtttgacataaaatgaattgagttggcgaaattattgaaatttgttaaatattgt |
44201736 |
T |
 |
| Q |
214 |
tgga |
217 |
Q |
| |
|
|||| |
|
|
| T |
44201735 |
tgga |
44201732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University