View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_511 (Length: 229)
Name: NF9288A_low_511
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_511 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 2 - 223
Target Start/End: Complemental strand, 4082858 - 4082634
Alignment:
| Q |
2 |
atttaatggttttgtttcttggcaaatgatgattgaagggtgtctggg-aattcaaattcctatagaaatatatatg--gttttgggaaatgatcaaatg |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4082858 |
atttaatggttttgtttcttggcaaatgatgattgaagggtgtctggggaattgaaattcctatagaaatatatatatagttttgggaaatgatcaaatg |
4082759 |
T |
 |
| Q |
99 |
gaaannnnnnnnnnnnnnnnnnnnnnnnnaagaaaaccgtatatggttgctcaaattttggagttgtagggaaggaaacatgtaggggaaagagagagtc |
198 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082758 |
gaaattttgttttttggtttggtttgttgaagaaaaccgtatatggttgctcaaattttggagttgtagggaaggaaacatgtaggggaaagagagagtc |
4082659 |
T |
 |
| Q |
199 |
taaacttggaaaatttagttgatag |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
4082658 |
taaacttggaaaatttagttgatag |
4082634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University