View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_531 (Length: 226)
Name: NF9288A_low_531
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_531 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 7e-79; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 72 - 220
Target Start/End: Complemental strand, 32656451 - 32656303
Alignment:
| Q |
72 |
tgaatgtgcttgttgtatactatagtggtcttattcctcacaatgtagttctattgagaatggtactcgtcatgagttgctttgcttgatcaagaaaact |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32656451 |
tgaatgtgcttgttgtatactatagtggtcttattcctcacaatgtagttctattgagaatggtactcgtcatgagttgctttgcttgatcaagaaaact |
32656352 |
T |
|
| Q |
172 |
acctcttccattttctcattgcgctaaaattttaataagttgtgtgaat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32656351 |
acctcttccattttctcattgcgctaaaattttaataagttgtgtgaat |
32656303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 86 - 191
Target Start/End: Complemental strand, 32653722 - 32653625
Alignment:
| Q |
86 |
gtatactatagtggtcttattcctcacaatgtagttctattgagaatggtactcgtcatgagttgctttgcttgatcaagaaaactacctcttccatttt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| | |||||||| |||||| || |||||| |||||||||| |||||||||||||| |
|
|
| T |
32653722 |
gtatactatagtggtcttattcctcacaatgtggttctactaagaatggt--tcgtcacgaattgctt------atcaagaaaatcacctcttccatttt |
32653631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 87 - 135
Target Start/End: Complemental strand, 32620606 - 32620558
Alignment:
| Q |
87 |
tatactatagtggtcttattcctcacaatgtagttctattgagaatggt |
135 |
Q |
| |
|
||||||||||||||||| ||||||||||| | |||||| | |||||||| |
|
|
| T |
32620606 |
tatactatagtggtcttcttcctcacaatatggttctactaagaatggt |
32620558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University