View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_536 (Length: 225)
Name: NF9288A_low_536
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_536 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 16 - 161
Target Start/End: Complemental strand, 41429539 - 41429394
Alignment:
| Q |
16 |
aatataactcgtctttacaggaaaactcaaacattctatcattaaaactgtcaatttgtaacaactcaatgcatttgggtgatcactgacgggtcactat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41429539 |
aatataactcgtctttacaggaaaactcaaacattctatcattaaaactgtcaatttgtaacaactcaatgcatttgggtgatcactgacgggtcactat |
41429440 |
T |
|
| Q |
116 |
attatagatcaggttggatttgccaaattaattacgaaccagtttt |
161 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41429439 |
attatagatcaggttggatttgcccaattaattacgaaccagtttt |
41429394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 145 - 205
Target Start/End: Complemental strand, 41429369 - 41429309
Alignment:
| Q |
145 |
aattacgaaccagttttccatcttattttcgttcttttgattttttgacatatgaattttc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41429369 |
aattacgaaccagttttccatcttattttcgttcttttgattttttgacatatgaattttc |
41429309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University