View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_537 (Length: 225)
Name: NF9288A_low_537
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_537 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 217
Target Start/End: Complemental strand, 18005008 - 18004805
Alignment:
| Q |
14 |
gacagggagtgtagggattggtagtggaggagctggtaatggaaagagtggtaattgattcttttctacttgtgtcttttcaatgttataattcttgctt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18005008 |
gacagggagtgtagggattggtagtggaggagctggtaatggaaagggtggtaactgattcttatctacttgtgtcttttcaatgttataattcttgctt |
18004909 |
T |
|
| Q |
114 |
ggattaacttgatcttctacctttcctccaccaataacttctttctccttgattggaatattcttgagttgtctagcaccacttatggtaacaaggttgt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
18004908 |
ggattaacttgatcttctacctttcctccaccaataacttctttctccttaattggaatattcttgaattgtctagaaccacttatggtaacaaagttgg |
18004809 |
T |
|
| Q |
214 |
tcat |
217 |
Q |
| |
|
|||| |
|
|
| T |
18004808 |
tcat |
18004805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 217
Target Start/End: Complemental strand, 20644547 - 20644344
Alignment:
| Q |
14 |
gacagggagtgtagggattggtagtggaggagctggtaatggaaagagtggtaattgattcttttctacttgtgtcttttcaatgttataattcttgctt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
20644547 |
gacagggagtgtagggattggtagtggaggagctggtaatggaaagggtggtaactgattcttatctacttgtgtcttttcaatgttataattcttgctt |
20644448 |
T |
|
| Q |
114 |
ggattaacttgatcttctacctttcctccaccaataacttctttctccttgattggaatattcttgagttgtctagcaccacttatggtaacaaggttgt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
20644447 |
ggattaacttgatcttctacctttcctccaccaataacttctttctccttaattggaatattcttgaattgtctagaaccacttatggtaacaaagttgg |
20644348 |
T |
|
| Q |
214 |
tcat |
217 |
Q |
| |
|
|||| |
|
|
| T |
20644347 |
tcat |
20644344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University