View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_538 (Length: 224)
Name: NF9288A_low_538
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_538 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 22 - 190
Target Start/End: Complemental strand, 42793722 - 42793550
Alignment:
| Q |
22 |
attcgtatcccttatcccttagctgttgagtgaaaatccctcatgttggtgcattgtgatggaccaaccagatacttattttagcgatgctttgaatcnn |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42793722 |
attcgtatcccttatcccttagctgttgagtgaaaatccctcatgttggtgcattgtgatggaccaaccagatacttattttagcgatgctttgaatcaa |
42793623 |
T |
 |
| Q |
122 |
nnnnnngatcagaacaagagttgccatgcc--atttaag--ctttcttttttccatatcaatgccatgtaaca |
190 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||| |||||||||||||||||| |||||||| |
|
|
| T |
42793622 |
aaaaaagatcagaacaagagttgccatgccttatttaagtctttttttttttccatatcaatgctatgtaaca |
42793550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University