View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_548 (Length: 222)
Name: NF9288A_low_548
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_548 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 47886211 - 47885991
Alignment:
| Q |
1 |
gacgttggtgtaaactagtttacattgattatgattgtcccttttctcttattatattatcatacacaattcnnnnnnngaaaaaatatatcatacacag |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47886211 |
gacgttggtgtaaactagtttacatcgattatgattgtcccttttctcttattatat-atcatacacaattctttttttgaaaaaatatatcatacacag |
47886113 |
T |
|
| Q |
101 |
ttctaaagttaaatatctcttattttttggttacaagttaaatatctcttatatatgaacataatattttacattgtaactttttgtctgtttctcattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47886112 |
ttctaaagttaaatatctcttattttttggttacaagttaaatatctcttatatatgaacataatattttacattgtaactttttgtctgtttctcattt |
47886013 |
T |
|
| Q |
201 |
ctaacatttgtgacttgatgct |
222 |
Q |
| |
|
| |||||||||||||||||||| |
|
|
| T |
47886012 |
caaacatttgtgacttgatgct |
47885991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University