View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_551 (Length: 221)
Name: NF9288A_low_551
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_551 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 20 - 208
Target Start/End: Complemental strand, 55080213 - 55080025
Alignment:
| Q |
20 |
atggtagagaaggctcagctcgttttcaagttggatggaatggatatcagaaaagaaagaagtagagacgttgtattgtggacttcgatgctcggtgtgt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55080213 |
atggtagagaaggctcagctcgttttcaagttggatggaatggatatcagaaaagaaagaagtagagacgttgtattttggacttcgatgctcggtgtgt |
55080114 |
T |
|
| Q |
120 |
atggtaaaaatgggcattataaggaagtaattgatttgtacagtgaaatgttgcgggaaggaatcaaacctgatggaatttcttttctg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
55080113 |
atggtaaaaatgggcattataaggaagtaattgatttgtacagtgaaatgttgcgggaaggaatcaaacctgatggaatttcatttctg |
55080025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University