View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_583 (Length: 210)
Name: NF9288A_low_583
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_583 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 21 - 210
Target Start/End: Complemental strand, 45566291 - 45566099
Alignment:
| Q |
21 |
gtcacaaaaacttaatatgatatttttccacaatgacaacttcatgatgtcatttcacaccgttcagatcatttccc----------agaactcgtggtt |
110 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45566291 |
gtcacacaaacttaatatgatatttttccacaatgacaacttcatgatgtcatttcacaccgttcagatcatttccctatacttttgagaactcgtggtt |
45566192 |
T |
|
| Q |
111 |
gctggaggaggaattagatggaattgtagttnnnnnnnnnnnnnntaggagaaaagtcaggatggagggattttgctcaggccgaagaattgtacagagg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45566191 |
gctggaggaggaattagatggaattgtagtt-------gggggggtaggagaaaagtcaggatggagggattttgctcaggctgaagaattgtacagagg |
45566099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University