View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_584 (Length: 209)
Name: NF9288A_low_584
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_584 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 40 - 124
Target Start/End: Complemental strand, 40130830 - 40130746
Alignment:
| Q |
40 |
tactaaccacatctttacaccgatgtgggtatgactaagggagagacctattatataaagcgcaaactatgagttaaggagtctc |
124 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40130830 |
tactaaccacatctttacaccgatatgggtatgactaagggagagacctattatataaagcgcaaattatgagttaaggagtctc |
40130746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 152 - 206
Target Start/End: Complemental strand, 39781013 - 39780959
Alignment:
| Q |
152 |
cttgttaagaatatcgtttgtggattttttgtaatcagttattcggttgtctgtt |
206 |
Q |
| |
|
||||||||| |||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
39781013 |
cttgttaagcatatcgtttgtggattttatgtattcagttattcggttgtctgtt |
39780959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University