View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_597 (Length: 204)
Name: NF9288A_low_597
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_597 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 31 - 184
Target Start/End: Complemental strand, 37938773 - 37938620
Alignment:
| Q |
31 |
gaacagaatgaggcaaagacagctacaattgaagcaggggagaccgagacaaaggtggaagaaatctctaaagctgtaaatgaacctgttagagaaacac |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37938773 |
gaacagaatgaggcaaagacagctacaattgaagcaggggagaccgagacaaaggtggaagaaatctctaaagctgtaaatgaacctgttagagaaacac |
37938674 |
T |
 |
| Q |
131 |
tggcatctaaattcgaaaaagacgaggaggaaactattcaaaatggagtggata |
184 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37938673 |
ttgcatctaaattcgaaaaagacgaggaggaaactattcaaaatggagtggata |
37938620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University