View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_60 (Length: 399)
Name: NF9288A_low_60
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_60 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 1e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 12 - 197
Target Start/End: Original strand, 47583166 - 47583350
Alignment:
| Q |
12 |
atgaagcagagagacagagatagatataggtaagtgatgatagatgcacgatgatgaagctttcaactcaataacatgaactgaatcctgaaccaaaatt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47583166 |
atgaagcagagagacagagatagatataggtaagtgatgatagatgcacgatgatgaagctttcaactcaataacatgaactgaatcctgaaccaaattt |
47583265 |
T |
|
| Q |
112 |
tcctagtacggagttaatatattcttgctttttaagtttttgacaccactgttgatttcacatcttgtatttattttacaccaaca |
197 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47583266 |
tcctagtacggagtt-atatattcatgctttttaagtttttgacaccactgttgatttcacatcttgtatttattttacatcaaca |
47583350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 227 - 379
Target Start/End: Original strand, 47583347 - 47583499
Alignment:
| Q |
227 |
aacaggtacgtgtcagttgccatgcagtgttactaattgctgctaactcatgttaacctaaatctcacttaacaagaatttaattggactattgtcaata |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583347 |
aacaggtacgtgtcagttgccatgcagtgttactaattgctgctaactcatgttaacctaaatctcacttaacaagaatttaattggactattgtcaata |
47583446 |
T |
|
| Q |
327 |
ttgggcttcatgattttgattttgatggaaaggcctcctcacttaatttccag |
379 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583447 |
ttgggcctcatggttttgattttgatggaaaggcctcctcacttaatttccag |
47583499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University