View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9288A_low_600 (Length: 202)

Name: NF9288A_low_600
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9288A_low_600
NF9288A_low_600
[»] chr4 (1 HSPs)
chr4 (20-174)||(38323207-38323361)


Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 20 - 174
Target Start/End: Complemental strand, 38323361 - 38323207
Alignment:
20 gtttttgaggttaagaagattcatggattgttgtttaaatttgggttggaattggatgtttttgttggaagtgctttggttactacttatttgaaatttt 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38323361 gtttttgaggttaagaagattcatggattgttgtttaaatttgggttggaattggatgtttttgttggaagtgctttggttactacttatttgaaatttt 38323262  T
120 ggttggttgtggatgcacatgaggtgtttgaggaattgcttgttagagatgttgt 174  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
38323261 ggttggttgtggatgcacatgaggtgtttgaggaattgcctgttagagatgttgt 38323207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University