View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_96 (Length: 358)
Name: NF9288A_low_96
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_96 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 8 - 343
Target Start/End: Complemental strand, 39964235 - 39963901
Alignment:
| Q |
8 |
cacagaagatttgcagggaagactgtgttttgagcgggaaacttagaagcaagttcgatcgaattcatagcaccatttctattttctttctgaaattgag |
107 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39964235 |
cacagaagatt-gtagggaagactgtgttttgagcgggaaacttagaagcaagttcgatcgaattcatagcaccatttctattttctttctgaaattgag |
39964137 |
T |
 |
| Q |
108 |
aacgcagtgacacagaaaacaaagcataaaccatagaaaaagatctactagttagggtttaataaccatggcggaggagacttatgctatggacatcgac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39964136 |
aacgcagtgacacagaaaacaaagcataaaccatagaaaaagatctactagttagggtttaataaccatggcggaggagacttatgctatggacatcgac |
39964037 |
T |
 |
| Q |
208 |
gttacagacaagggcaaaaccgtcattgccgccggtaacccttccttcggtggcaaagcttcgctatgggttgaaaagtatcgtcctcaatccctcgacg |
307 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39964036 |
gtcacagacaagggcaaaaccgtcattgccgccggtaacccttccttcggtggcaaagcttcgctatgggttgaaaagtatcgtcctcaatccctcgacg |
39963937 |
T |
 |
| Q |
308 |
acgttgcagctcaccgcgacatcgttgacacaagta |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39963936 |
acgttgcagctcaccgcgacatcgttgacacaagta |
39963901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University