View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288_high_8 (Length: 293)
Name: NF9288_high_8
Description: NF9288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 181 - 290
Target Start/End: Complemental strand, 39781149 - 39781040
Alignment:
| Q |
181 |
agtgttaatttgatgggtttgaattgaaaagttatataaaataacatattcataaattttttgctattagctatagctatttataatattagaggtttag |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39781149 |
agtgttaatttgatgggtttgaattgaaaagttatataaaataacatattcataaaatttttgctattagctatagctatttataatattagaggtttag |
39781050 |
T |
 |
| Q |
281 |
ggagttcaga |
290 |
Q |
| |
|
|||||||||| |
|
|
| T |
39781049 |
ggagttcaga |
39781040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University