View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288_low_27 (Length: 351)
Name: NF9288_low_27
Description: NF9288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 16 - 340
Target Start/End: Original strand, 35460688 - 35461010
Alignment:
| Q |
16 |
ataagaacacaactctatattttcattcaaaactttaaaacatatatgttgcnnnnnnnnnnatatattcaacatttagtcgatttaaaattgaagtaaa |
115 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||| ||||||||||||| ||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
35460688 |
ataagagcacaatcctatattttcattcaaaactttatgacatatatgttgcttttttt---atatatttaacatttagtcgatttaaatttgaagtaag |
35460784 |
T |
|
| Q |
116 |
acttgtacccaaaaacaaaaattgaagtaagactactccatacattattcttccaatttgctccaagttggtggctcaaggtt-aaactacccgcaagga |
214 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35460785 |
acttgtacccaaaaataaaaattgaagacagactactccatacattattcttccaatttgctccaagttggtggctcaaggtttaaactacccgcaagga |
35460884 |
T |
|
| Q |
215 |
tgatatcatcgagtttggcactacgattaagaattataggcaaacaaatgtaaacaaatctttatattaagtaggaaggaggcaaatgggaatttctcac |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35460885 |
tgatatcatcgagtttggcactacgattaagaattataggcaaacaaatgtaaaaaaatctttatattaagtaggaaggaggcaaatgggaatttctcac |
35460984 |
T |
|
| Q |
315 |
actttagtcaagtttgctacacctat |
340 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
35460985 |
actttagtcaagtttgctacacctat |
35461010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University