View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288_low_31 (Length: 340)
Name: NF9288_low_31
Description: NF9288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288_low_31 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 8 - 340
Target Start/End: Complemental strand, 43672735 - 43672403
Alignment:
| Q |
8 |
gagcagagagtggcatagatggaattttagggaaccttttcaaaacttcattatcatccaaactcaacttctcactaccttcaacactaccccaaccagg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672735 |
gagcagagagtggcatagatggaattttagggaaccttttcaaaacttcattatcatccaaactcaacttctcactaccttcaacactaccccaaccagg |
43672636 |
T |
 |
| Q |
108 |
actaagtgggtcccctacacctttcatcacgtgacctctctcaaacccatcacgccacgtgtcattctcatcattataaaccagaaccgctacagcaccg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43672635 |
actaagtgggtcccctacacctttcatcacgtgacctctctcaaacccattacgccacgtgtcattctcatcattataaactagaaccgctacagcaccg |
43672536 |
T |
 |
| Q |
208 |
ttttcctcagccttttcaaccaccgtgttcctccctaaaccaccaccttttcttactatcactatacatcccttaatgcttacgccaactgcacggtagt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672535 |
ttttcctcagccttttcaaccaccgtgttcctccctaaaccaccaccttttcttactatcactatacatcccttaatgcttacgccaactgcacggtagt |
43672436 |
T |
 |
| Q |
308 |
ctctatctcttccgtagttcacaaacaccgcct |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43672435 |
ctctatctcttccgtagttcacaaacaccgcct |
43672403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University