View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288_low_33 (Length: 334)
Name: NF9288_low_33
Description: NF9288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 73 - 317
Target Start/End: Original strand, 51104639 - 51104883
Alignment:
| Q |
73 |
aatccacctcctagtcaacactctttcagtgttcaacccaactttctgcttgggacctcatttggagcttagttactgaacattatttattaggatttat |
172 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||| |||||||||||| || |||||| |
|
|
| T |
51104639 |
aatccacctcctagtcaatactctttcagtgttcaaccgaactgtctgcttgggacctcatttggagctgagttacttaacattatttatcagtatttat |
51104738 |
T |
 |
| Q |
173 |
ttctatgaatggcatctattagaagaaccttgtctcctgttcctctacccgcaactgcagcaaatgtagatgtctgttcagtatcttccccgttgtctaa |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51104739 |
ttctatgaatggcatctattagaagaaccttgtctcctgttcctcgacccgcaactgcagcaaatgtagatgtctgttcagtatcttccccgttgtctaa |
51104838 |
T |
 |
| Q |
273 |
gtcctcacctagcccccagaagtttgttccatcctatggattttt |
317 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51104839 |
gtcctcacctagcccccagaagttttttccatcctatggattttt |
51104883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University