View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288_low_37 (Length: 286)
Name: NF9288_low_37
Description: NF9288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 247
Target Start/End: Original strand, 22655559 - 22655790
Alignment:
| Q |
16 |
taaagaacgtaatgccttgcttgatcaggaaattgaattttaataaaatgattctgtttatgtgtgtctcttaaataagaaaagcatacccctctaagat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
22655559 |
taaagaacgtaatgccttgcttgatcaggaaattgatttttaataaaatgattctgtttatgtgtgtctcttaaataagaaaagcatacccctctaggat |
22655658 |
T |
 |
| Q |
116 |
gtgctttagtttgaacacgtagatgtttactatttcat-tatggacaagnnnnnnnccgaccaaattatgttgatggacaagttactttatctcactgtc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
22655659 |
gtgctttagtttgaacacgtagatgtttactatttcatatatggacaag-ttttttccgaccaaattatgtggatggacaagttactttatatcactgtc |
22655757 |
T |
 |
| Q |
215 |
acctatattaaatatcactctttattgtttgat |
247 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |
|
|
| T |
22655758 |
acttatattaaatatcactctttattgtttgat |
22655790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University