View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288_low_38 (Length: 284)
Name: NF9288_low_38
Description: NF9288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 22 - 267
Target Start/End: Complemental strand, 567602 - 567357
Alignment:
| Q |
22 |
taattaaaattaaaggttatgtttgattggttaccttagctcctaacagcttcatcaaccgtacattagatgattgtctgtccatgtctttagcagccat |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
567602 |
taattaaaattaaaggttatgtttgattggttaccttagctcctaacagcttcatcaaccgtacattagatgattgtctgtccatgtctttcgcagccat |
567503 |
T |
 |
| Q |
122 |
aaagactatgcactccaaagcaagttttgcgcatgcagcagctgttgcaagcccgtgatgtcctgaaccggtggccgtaacgacactttttagaccgatg |
221 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
567502 |
aaagactgtgcactccaaagcaagttttgcgcatgcagcagctgttgctagcccgtgatgtcctgaaccggtggccgtaacgacactttttagaccgatg |
567403 |
T |
 |
| Q |
222 |
cgcttggcaatcatagcttgtgcaagagcattgttcatcttgtgag |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
567402 |
cgcttggcaatcatagcttgtgcaagagcattgttcatcttgtgag |
567357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University