View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288_low_49 (Length: 265)
Name: NF9288_low_49
Description: NF9288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 11 - 249
Target Start/End: Original strand, 34876471 - 34876701
Alignment:
| Q |
11 |
cacagaagaacccctcatagttgccatgattatgtcaaattctcctactgcataaatatgtcaccgtcgcaccaaatttatcaacacagttagaataata |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| ||||||| ||||| |
|
|
| T |
34876471 |
cacagaagaacccctcatagttgccatgattatgtcaaattctccttctgcataaatatgtcaccgtcacaccaaaattatcaa-----------taata |
34876559 |
T |
 |
| Q |
111 |
acagtatatgtgacagaaggataactaatataagcagatgaatcgacaagagctgaatctctttggatcgtgtaacgaaaacttnnnnnnnnnnnn---t |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
34876560 |
acagtatatgtgacagaaggataactaatataagcagatgaatcgacaagagctgaatctctatggatcgtgtaacgaaaacttaaaaaaaaataaaaat |
34876659 |
T |
 |
| Q |
208 |
tagttagagattaaatttacagtaattgattactcaccagtg |
249 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
34876660 |
tagttagagactaaagttacagtaattgattactcaccagtg |
34876701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University