View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288_low_73 (Length: 229)
Name: NF9288_low_73
Description: NF9288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288_low_73 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 86
Target Start/End: Original strand, 3184784 - 3184862
Alignment:
| Q |
8 |
agtagcataggcagatatagttatctctccatcttccattgaattcaatattgatttgattttgttcactaaaccaacc |
86 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3184784 |
agtatcataagcagatatagttatctctccatcttccattgaattcaatattgatttgattttgttcactaaaccaacc |
3184862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 82
Target Start/End: Complemental strand, 3224933 - 3224859
Alignment:
| Q |
8 |
agtagcataggcagatatagttatctctccatcttccattgaattcaatattgatttgattttgttcactaaacc |
82 |
Q |
| |
|
|||| |||| ||||| ||| || ||| ||||||||||| |||| ||||||||||||||||| |||||||||||| |
|
|
| T |
3224933 |
agtatcataagcagacatatttgtctttccatcttccaatgaactcaatattgatttgattgagttcactaaacc |
3224859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University