View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288_low_74 (Length: 229)
Name: NF9288_low_74
Description: NF9288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288_low_74 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 52982608 - 52982386
Alignment:
| Q |
1 |
caatttgtttatttattagccactaatcctatttatttgtggattaactgtccaaatttctatacgtacgagctccctctatcacgtagtgttatgctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52982608 |
caatttgtttatttattagccactaatcctatttatttgtggattaactgtccaaatttctatacgtacgagctccctctatcacgtagtgttatgctct |
52982509 |
T |
|
| Q |
101 |
gtttcgcatacaagagaacaatactactgtctgcgattttgtgcatacaaactctctctcaccttgctatgttcacttttgctatgttttggatgcaaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52982508 |
gtttcgcatacaagagaacaatactacagtctgcgactttgtgcatacaaactctctctcaccttgctatgttcacttttgctatgttttggatgcaaga |
52982409 |
T |
|
| Q |
201 |
taacaaagttctcttcttcgcta |
223 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
52982408 |
tagcaaagttctcttcttcgcta |
52982386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 73 - 219
Target Start/End: Complemental strand, 55663313 - 55663162
Alignment:
| Q |
73 |
ctccctctatcacgtagtgttatgctctgtttcgcatacaagagaacaatactactgtctgcgattttgtgcatacaaactctc--tctcaccttgctat |
170 |
Q |
| |
|
|||| ||| |||||||||||| |||| ||||||| ||||||||| ||| |||| ||| || || ||| ||||||||||||||| ||||||| |||| | |
|
|
| T |
55663313 |
ctccttctctcacgtagtgttctgctttgtttcggatacaagaggacatcactattgtgtgtgactttatgcatacaaactctctttctcaccgtgcttt |
55663214 |
T |
|
| Q |
171 |
gtt---cacttttgctatgttttggatgcaagataacaaagttctcttcttc |
219 |
Q |
| |
|
||| || |||| || | |||||||| ||||| |||||||||||||||||| |
|
|
| T |
55663213 |
gttttgcaattttactctattttggattcaagagaacaaagttctcttcttc |
55663162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 223
Target Start/End: Complemental strand, 7736925 - 7736882
Alignment:
| Q |
180 |
tgctatgttttggatgcaagataacaaagttctcttcttcgcta |
223 |
Q |
| |
|
|||| ||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
7736925 |
tgctctgtttgggatgcaagagaacaaagttctcttcttcgcta |
7736882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 223
Target Start/End: Complemental strand, 24019881 - 24019838
Alignment:
| Q |
180 |
tgctatgttttggatgcaagataacaaagttctcttcttcgcta |
223 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
24019881 |
tgctttgttttggatgcaatagaacaaagttctcttcttcgcta |
24019838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University