View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288_low_75 (Length: 228)
Name: NF9288_low_75
Description: NF9288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288_low_75 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 33966750 - 33966960
Alignment:
| Q |
1 |
aattgtatcaaaatctccaaaagaaggattcttatcaacgtgcaaagtataagaagcaaatagcttattttttgcagccttgtaaacagtgtgtttgaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33966750 |
aattgtatcaaaatctccaaaagaaggattcttatcaacgtgcaaagtataagaagcaaatagcttattttttgcagccttgtaaacagtgtgtttgaga |
33966849 |
T |
 |
| Q |
101 |
ccaccaacaaaactcacccatttcgtgaattgttgttctgctaagtctgctcttgttgtattgtaggttgataaaccgtttcgagcggaacgtatcggtc |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33966850 |
ccaccaacaaaactcacccatttcatgaattgttgttctgctaagtctgctcttgttgtattgtaggttgataaaccgtttcgagcagaacgtatcggtc |
33966949 |
T |
 |
| Q |
201 |
gaattcctttt |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
33966950 |
gaattcctttt |
33966960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 32 - 140
Target Start/End: Complemental strand, 43076797 - 43076689
Alignment:
| Q |
32 |
ttatcaacgtgcaaagtataagaagcaaatagcttattttttgcagccttgtaaacagtgtgtttgagaccaccaacaaaactcacccatttcgtgaatt |
131 |
Q |
| |
|
|||| ||||| |||||||||||||| ||| ||||||||||| || | | | ||||| |||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
43076797 |
ttataaacgttcaaagtataagaaggaaaaagcttatttttggctgttctaaagacagtatgtttgagaccaccaacaaatttcacccatttcatgaatt |
43076698 |
T |
 |
| Q |
132 |
gttgttctg |
140 |
Q |
| |
|
||||||||| |
|
|
| T |
43076697 |
gttgttctg |
43076689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University