View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288_low_77 (Length: 223)
Name: NF9288_low_77
Description: NF9288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288_low_77 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 20 - 211
Target Start/End: Complemental strand, 39601235 - 39601044
Alignment:
| Q |
20 |
ggatctggagtgccgtcaactagtagtgaaggaaacaaaacatgacaggtcaaattgtatgctgatgggtggaaattatgtgcttcaacttctaaccatt |
119 |
Q |
| |
|
|||||||||| || | || ||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39601235 |
ggatctggagagctgccacctagtagtgtaggacacaaaacatgacaggtcaaattgtatgctgatgggtggaaattatgtgcttcaacttctaaccatt |
39601136 |
T |
|
| Q |
120 |
gttccacaaggcccttttcttctattgtctttcctagtaactcaaccccttgagatctatatttttcagcatagtatctcattattgcccta |
211 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39601135 |
gttccacaagacccttttcttctattgtctttcctagtaactcaaccccttgagatctatatttttcagcatagtatctcattattgcccta |
39601044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 20 - 211
Target Start/End: Complemental strand, 39612056 - 39611865
Alignment:
| Q |
20 |
ggatctggagtgccgtcaactagtagtgaaggaaacaaaacatgacaggtcaaattgtatgctgatgggtggaaattatgtgcttcaacttctaaccatt |
119 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| | ||| ||||| |||| ||||| || || |||||||||||||||||||||| |
|
|
| T |
39612056 |
ggatctggagtgccgtcaaccagtagtgaaggaaacaaaacatgaatgaccaagttgtaagctggtgggttaaagttgtgtgcttcaacttctaaccatt |
39611957 |
T |
|
| Q |
120 |
gttccacaaggcccttttcttctattgtctttcctagtaactcaaccccttgagatctatatttttcagcatagtatctcattattgcccta |
211 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
39611956 |
gttccacaagacccttttcttctattgtctttcctagcaactcaaccccttgagatctatatttttctgcataatatctcattattgcccta |
39611865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 85 - 195
Target Start/End: Complemental strand, 17647192 - 17647082
Alignment:
| Q |
85 |
tgggtggaaattatgtgcttcaacttctaaccattgttccacaaggcccttttcttctattgtctttcctagtaactcaaccccttgagatctatatttt |
184 |
Q |
| |
|
||||| ||| ||||||||||||||||||| |||||| |||||||| ||| ||||||||||||||||||| || || ||| ||||||| | | || ||| |
|
|
| T |
17647192 |
tgggttgaagttatgtgcttcaacttctagccattgctccacaagacccctttcttctattgtctttccaagcaaatcagtcccttgatttttgtacttt |
17647093 |
T |
|
| Q |
185 |
tcagcatagta |
195 |
Q |
| |
|
||||||||||| |
|
|
| T |
17647092 |
tcagcatagta |
17647082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 85 - 155
Target Start/End: Original strand, 17572955 - 17573025
Alignment:
| Q |
85 |
tgggtggaaattatgtgcttcaacttctaaccattgttccacaaggcccttttcttctattgtctttccta |
155 |
Q |
| |
|
|||||| || ||||||||||| ||||| | ||||||||||||||| ||| ||||||||| |||||||||| |
|
|
| T |
17572955 |
tgggtgaaagttatgtgcttccacttcaagccattgttccacaagacccctttcttctaccgtctttccta |
17573025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 23 - 106
Target Start/End: Complemental strand, 34774371 - 34774287
Alignment:
| Q |
23 |
tctggagtgccgtcaactagtagtgaaggaaacaaaacatgacaggtc-aaattgtatgctgatgggtggaaattatgtgcttca |
106 |
Q |
| |
|
|||||| ||||| || |||||||||||||| |||||||||| ||||| ||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
34774371 |
tctggattgccgccagctagtagtgaaggacgcaaaacatgataggtcaaaattgtatgctggtgggtggaagatatgtgcttca |
34774287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University