View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288_low_80 (Length: 215)
Name: NF9288_low_80
Description: NF9288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288_low_80 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 56 - 166
Target Start/End: Complemental strand, 3122852 - 3122742
Alignment:
| Q |
56 |
cctcggagccacatttcaccttcttttccataacacagacgccgattttgattttctctgtaatcttctccatgatcttcttcttctcacagaataatca |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3122852 |
cctcggagccacatttcaccttcttttccataacacagacgccgattttgattttctctgtaatcttctccatgatcttcttcttctcacagaataatct |
3122753 |
T |
|
| Q |
156 |
cttattctttc |
166 |
Q |
| |
|
||||||||||| |
|
|
| T |
3122752 |
cttattctttc |
3122742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 95
Target Start/End: Complemental strand, 1913799 - 1913760
Alignment:
| Q |
56 |
cctcggagccacatttcaccttcttttccataacacagac |
95 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
1913799 |
cctcgaagccacatttcaccttcttttccatcacacagac |
1913760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University